longest sequence

Newbie Member
17May2008,20:44   #1
skunk's Avatar
hello,

could some one please help me find the longest protein seqence only after ruuning the following code?
Code:
#!/usr/local/bin/perl
#7_transorfs.pl
#Author: Paul Stothard, Genome Canada Bioinformatics Help Desk
#This script reads a single DNA sequence (in FASTA format) from a file and 
#then generates the protein translations of ORFs found in any of the six
#reading frames.

use warnings;
use strict;

#Declare a variable to hold the minimum ORF size you want to be returned
#(in bases).
my $MINORF = 102;

#Declare a hash table for translating DNA into protein.
my %translationHash = 
    (gca => "A", gcg => "A", gct => "A", gcc => "A", gcn => "A",
     tgc => "C", tgt => "C",
     gat => "D", gac => "D",
     gaa => "E", gag => "E",
     ttt => "F", ttc => "F",
     gga => "G", ggg => "G", ggc => "G", ggt => "G", ggn => "G",
     cat => "H", cac => "H",
     ata => "I", att => "I", atc => "I",
     aaa => "K", aag => "K",
     cta => "L", ctg => "L", ctt => "L", ctc => "L", ctn => "L", tta => "L", ttg => "L",
     atg => "M",
     aat => "N", aac => "N",
     cca => "P", cct => "P", ccg => "P", ccc => "P", ccn => "P",
     caa => "Q", cag => "Q",
     cga => "R", cgg => "R", cgc => "R", cgt => "R", cgn => "R",
     aga => "R", agg => "R",
     tca => "S", tcg => "S", tcc => "S", tct => "S", tcn => "S",
     agc => "S", agt => "S",
     aca => "T", acg => "T", acc => "T", act => "T", acn => "T",
     gta => "V", gtg => "V", gtc => "V", gtt => "V", gtn => "V",
     tgg => "W",
     tat => "Y", tac => "Y",
     tag => "*", taa => "*", tga => "*");

#Obtain the DNA sequence from a file.
print "Enter the name of the sequence file (try mediumseq.txt) and then press Enter:\n";
my $fileToRead = <STDIN>;
chomp($fileToRead);
open (DNAFILE, $fileToRead) or die( "Cannot open file : $!" );
$/ = undef;
my $directStrand = <DNAFILE>;
my $sequenceTitle = "";
if ($directStrand =~ m/(>[^\n]+)/){
   $sequenceTitle = $1;
   $sequenceTitle =~ s/>//;
}
else {
    die( "A FASTA sequence title was not found." );
}

#Once you are done with a file, close the filehandle.
close (DNAFILE) or die( "Cannot close file : $!");

#Filter the DNA sequence.
$directStrand =~ s/>[^\n]+//;
$directStrand =~ tr/GATCN/gatcn/;
$directStrand =~ s/[^gatcn]//g;

#Determine the reverse-complement of the sequence. The reverse-complement
#will be used when looking for ORFs on the opposite strand.
my $reverseComplement = $directStrand;
$reverseComplement =~ tr/gatcn/ctagn/;
my @arrayOfBases = split(/\B/, $reverseComplement);
my @reversedArray = reverse(@arrayOfBases);
$reverseComplement = join("",@reversedArray);

#Declare an array to hold the ranges of ORFs found in the sequence.
my @arrayOfORFs = ();

#Declare an array to hold the translations of ORFs.
my @arrayOfTranslations = ();

#Below is the ORF finding code from the previous example, with some
#differences. The first difference is that an outer for loop has
#been added to the ORF finding code, so that it executes twice--
#once for the direct strand, and once for the reverse-complement.
#The other change is that the codon range description includes
#a variable that is set to "+" for the first iteration of the
#for loop, and "-" for the second iteration.
for (my $i = 0; $i < 2; $i = $i + 1) {
    my $sequenceEntry = "";
    my $strand = "";
    if ($i == 0) {
	#the first time the ORF finding code executes we will search
	#for ORFs on the direct strand.
	$sequenceEntry = $directStrand;
	$strand = "+";
    }
    else {
	#the second time the ORF finding code executes we will search
	#for ORFs on the reverse-complement.
	$sequenceEntry = $reverseComplement;
	$strand = "-";
    }

    my @startsRF1 =();
    my @startsRF2 =();
    my @startsRF3 =();
    my @stopsRF1 = ();
    my @stopsRF2 = ();
    my @stopsRF3 = ();

    while ($sequenceEntry =~ m/atg/gi){
	my $matchPosition = pos($sequenceEntry) - 3;
	if (($matchPosition % 3) == 0) {
	    push (@startsRF1, $matchPosition);
	}
	elsif ((($matchPosition + 2) % 3) == 0) {
	    push (@startsRF2, $matchPosition);
	}
	else {
	    push (@startsRF3, $matchPosition);
	}
    }

    while ($sequenceEntry =~ m/tag|taa|tga/gi){
	my $matchPosition = pos($sequenceEntry);
	if (($matchPosition % 3) == 0) {
	    push (@stopsRF1, $matchPosition);
	}
	elsif ((($matchPosition + 2) % 3) == 0) {
	    push (@stopsRF2, $matchPosition);
	}
	else {
	    push (@stopsRF3, $matchPosition);
	}
    }

    my $codonRange = "";
    my $startPosition = 0;
    my $stopPosition = 0;

    @startsRF1 = reverse(@startsRF1);
    @stopsRF1 = reverse(@stopsRF1);
    while (scalar(@startsRF1) > 0) {
	$codonRange = "";
	$startPosition = pop(@startsRF1);
	if ($startPosition < $stopPosition) {
	    next;
	}
	while (scalar(@stopsRF1) > 0) {
	    $stopPosition = pop(@stopsRF1);
	    if ($stopPosition > $startPosition) {
		last;
	    }
	}
	if ($stopPosition <= $startPosition) {
	    $stopPosition = length($sequenceEntry) - (length($sequenceEntry) % 3);
	    $codonRange = $strand . "1 " . $startPosition . ".." . $stopPosition;
	    push (@arrayOfORFs, $codonRange);
	    last;
	}
	else {
	    $codonRange = $strand . "1 " . $startPosition . ".." . $stopPosition;
	    push (@arrayOfORFs, $codonRange);
	}
    }

    $stopPosition = 0;
    @startsRF2 = reverse(@startsRF2);
    @stopsRF2 = reverse(@stopsRF2);
    while (scalar(@startsRF2) > 0) {
	$codonRange = "";
	$startPosition = pop(@startsRF2);
	if ($startPosition < $stopPosition) {
	    next;
	}
	while (scalar(@stopsRF2) > 0) {
	    $stopPosition = pop(@stopsRF2);
	    if ($stopPosition > $startPosition) {
		last;
	    }
	}
	if ($stopPosition <= $startPosition) {
	    $stopPosition = length($sequenceEntry) - ((length($sequenceEntry) + 2) % 3);
	    $codonRange = $strand . "2 " . $startPosition . ".." . $stopPosition;
	    push (@arrayOfORFs, $codonRange);
	    last;
	}
	else {
	    $codonRange = $strand . "2 " . $startPosition . ".." . $stopPosition;
	    push (@arrayOfORFs, $codonRange);
	}
    }

    $stopPosition = 0;
    @startsRF3 = reverse(@startsRF3);
    @stopsRF3 = reverse(@stopsRF3);
    while (scalar(@startsRF3) > 0) {
	$codonRange = "";
	$startPosition = pop(@startsRF3);
	if ($startPosition < $stopPosition) {
	    next;
	}
	while (scalar(@stopsRF3) > 0) {
	    $stopPosition = pop(@stopsRF3);
	    if ($stopPosition > $startPosition) {
		last;
	    }
	}
	if ($stopPosition <= $startPosition) {
	    $stopPosition = length($sequenceEntry) - ((length($sequenceEntry) + 1) % 3);
	    $codonRange = $strand . "3 " . $startPosition . ".." . $stopPosition;
	    push (@arrayOfORFs, $codonRange);
	    last;
	}
	else {
	    $codonRange = $strand . "3 " . $startPosition . ".." . $stopPosition;
	    push (@arrayOfORFs, $codonRange);
	}
    }
}

#Use a loop to examine each ORF description in @arrayOfORFs. Translate ORFs that are
#longer than $MINORF, and add those translations to @arrayOfTranslations
foreach(@arrayOfORFs) {
    
    #Use the matching operator to copy parts of the ORF range into variables.
    #The strand will be stored in $1, the reading frame in $2, the start of
    #the ORF in $3, and the end of the ORF in $4.
    $_ =~ m/([\+\-])(\d)\s(\d+)\.\.(\d+)/;

    #Skip ORFs that are smaller than $MINORF
    if (($4 - $3) < $MINORF) {
	next;
    }

    #Declare a variable to hold the DNA sequence of the ORF.
    my $ORFsequence = "";

    #If the ORF is on the forward strand, use "substr" to obtain the sequence
    #of the ORF from $directStrand. Otherwise, obtain the sequence from 
    #$reverseComplement.
    if ($1 eq "+") {
	$ORFsequence = substr($directStrand, $3, $4 - $3);
    }
    else {
	$ORFsequence = substr($reverseComplement, $3, $4 - $3);
    }

    #Now use a for loop to translate the ORF sequence codon by codon.
    #The amino acids are added as elements to the array @growingProtein.
    my @growingProtein = ();
    for (my $i = 0; $i <= (length($ORFsequence) - 3); $i = $i + 3) {
	my $codon = substr($ORFsequence, $i, 3);
	if (exists( $translationHash{$codon} )){
	    push (@growingProtein, $translationHash{$codon});
	}
	else {
	    push (@growingProtein, "X");
	}
    }

    #Now convert the @growingProtein array to a string.
    my $joinedAminoAcids = join("",@growingProtein);

    #Add a title to the protein sequence before adding it to @arrayOfTranslations.
    #For ORFs on the reverse strand adjust the position numbers so that they refer
    #to the direct strand.
    if ($1 eq "+") {
	$joinedAminoAcids = ">" . "ORF rf " . $1 . $2 . ", from " . ($3 + 1) .
	    " to " . $4 . ", " . ($4 - $3) . " bases.\n" . $joinedAminoAcids;
    }
    else {
	$joinedAminoAcids = ">" . "ORF rf " . $1 . $2 . ", from " . 
	(length($directStrand) - $4 + 1) . " to " . (length($directStrand) - $3) . 
	    ", " . ($4 - $3) . " bases.\n" . $joinedAminoAcids;
    }
    #The text contained in $joinedAminoAcids can now be added on to our array
    #of protein translations.
    push (@arrayOfTranslations, $joinedAminoAcids);
}

#Now display the results.
print "Translated ORFs for $sequenceTitle, length = " . length($directStrand) . " bp.\n";
print "minimum ORF size kept = " . $MINORF . " bases.\n\n";
foreach(@arrayOfTranslations) {
    print "$_ \n\n";
}


#Once your script is working using mediumseq.txt, try using sars.txt
#as the input.
the following is the mediumseq.txt:

>random sequence
ttatgaatcggggcctaagctgctattgtacattgggaggacgtaccaat agtgtcttgg
ctttcgacgactaccattgttctgggtttcaggagtaaacccactatacg aagttagaga
tggttgagaaaacttcgcgaaatgatacaagaggatgttcatattcaact ggccgcgcca
tataacgcgatcgttgttcaaacaaaagtccaagaagactttccacgtcc acagctgccg
agatcgagtcgggatgtaagctgggactaagtccacaacaggccgatgat ggttccgaca
ctgcaggggagatacctaaacgccgactcactctgatcgaccaaccatcg atacggcaac
tggacgtacaaaagcttggcctggcggcgctgccttcatgcagaaagacc aacgaacgag
gattaaccagtgtggaatccgaagaaaactctccgcatcgataggtcagc taccaacaca
gagaaagagtaccgtcgtttctcgctctatctcatatatcagtgacatct tgacggattc
gacagcagagtaacttaccaatctactttcacggcatgagttaagaaacg ctaggctcgc
aaagtagactaggaatttatagaggtgacggatatccccgtgactaataa tcttgcactc
ccagaaaaaacaaaggattaagcttaagtaaatccaaagaccgcgttcca agatgcaatt
agcacctgagtattttatagatgcccgtccatttggcaaccctttcctta agacgagctt
atctagtgccattttcaaaatgcgaaccctttgccatagcctcagtttag gactactaac
ctatcccacgcgctaggagggtgtggcaacactgacacacatgctgcttg ctaaaagcag
tcggtacaaccgacagaattactttaaccacgcctgaaccaagtgtttaa acagatgact
cgcaatgatggtgtaaatgctaaatgtttatatgcgtccg

Last edited by shabbir; 18May2008 at 11:23.. Reason: Code block - http://www.go4expert.com/forums/misc.php?do=bbcode#code
Team Leader
20May2008,09:59   #2
pradeep's Avatar
Hi skunk, unfortunately none of us here is a genetic expert, so it'd be nice if you could tell us, what's wrong with your code!
Banned
7Jul2008,15:56   #3
gprunescape22's Avatar
Please sell your wares elsewhere

Last edited by jwshepherd; 10Jul2008 at 01:06.. Reason: SPAM
Invasive contributor
7Jul2008,16:12   #4
XXxxImmortalxxXX's Avatar
Stop Spamming This Crap Dude God
Invasive contributor
7Jul2008,16:13   #5
XXxxImmortalxxXX's Avatar
Bann Gprunescape